Questions about using mixcr to build reference genes

[CoooooolM]

Hello, I am using mixcr to construct reference genes of Chondrichthyes. The gene source is IMGT. In this process, I met "CommandLine $ExecutionException: Error while running the command buildLibrary Java lang. IllegalArgumentException: Gene conflict: U50607 ". How can I solve it? I have uploaded my command code and error to the attachment, thank you.

[mizraelson]

To create a reference library, the sequences must be clearly defined. In your V genes FASTA file, all V genes contain ambiguous nucleotides in their sequences, which is not allowed for the reference.

For example:

>AF336094|IGHV2S8*01|Orectolobus maculatus|(F)|V-REGION| | | | | | | | | | |
acaagggtagaccaaacaccaagaacaNNNgcaacaaaagagacgggcgaatcactgacc
atcaactgcgtcctaagagatgctagttacNNNNNNNNNNNNggatcggagaggacgggc
tggtatcggacaaaattgggttcaacaNNNaacgagcagNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNacaatatcaattggcNNNggacgatatgttgaaacagtc
aacaagggatcaaagtccttttctctgagaattcgtgatctgagagttgaagacagtggc
acgtataagtgtggagca

​This is why you see the following message for all V genes:

Sequence dropped because contain wildcards: AF003853|IGHV1S1*01|Hydrolagus colliei|(F)|V-REGION| | | | | | | | | | |

​Additionally, the headers of the sequences need to be updated. MiXCR uses the first element of the header as the gene name. For example, in the following case:

>U50607|IGHJ4*01|Carcharhinus plumbeus|(F)|J-REGION
>U50607|IGHV1S5*01|Carcharhinus plumbeus|(F)|V-REGION

MiXCR will try to assign the same name (U50607) to both IGHJ401 and IGHV1S501, causing a conflict and resulting in an error.

You should change the headers to something like this:

>IGHJ4*01|Carcharhinus plumbeus|(F)|J-REGION
>IGHV1S5*01|Carcharhinus plumbeus|(F)|V-REGION