Skip to content

meint52/DnaFeaturesViewer

 
 

Repository files navigation

DNA Features Viewer

DNA Features Viewer Logo

Travis CI build status https://coveralls.io/repos/github/Edinburgh-Genome-Foundry/DnaFeaturesViewer/badge.svg?branch=master

DNA Features Viewer (full documentation here) is a Python library to visualize DNA features, e.g. from GenBank or GFF files, or Biopython SeqRecords:

DNA Features Viewer automatically produce simple and clear plots even for sequences with many overlapping features and long labels. The libray plays well with Matplotlib and Biopython, and the plots can be output to many different formats (PNG, JPEG, SVG, PDF), e.g. for report generation, article figures, or LIMS interfaces.

Installation

If you have PIP installed, just type in a terminal:

pip install dna_features_viewer

DNA Features Viewer can be installed by unzipping the source code in one directory and using this command:

python setup.py install

If you intend to use the bokeh features, you need to also install Bokeh and Pandas:

pip install bokeh pandas

To parse GFF files, install the bcbio-gff library:

pip install bcbio-gff

Examples of use

Basic plots

In this first example we define features "by hand":

from dna_features_viewer import GraphicFeature, GraphicRecord
features=[
    GraphicFeature(start=0, end=20, strand=+1, color="#ffd700",
                   label="Small feature"),
    GraphicFeature(start=20, end=500, strand=+1, color="#ffcccc",
                   label="Gene 1 with a very long name"),
    GraphicFeature(start=400, end=700, strand=-1, color="#cffccc",
                   label="Gene 2"),
    GraphicFeature(start=600, end=900, strand=+1, color="#ccccff",
                   label="Gene 3")
]
record = GraphicRecord(sequence_length=1000, features=features)
record.plot(figure_width=5)

If we replace GraphicRecord by CircularGraphicRecord in the code above we obtain a circular plot of the construct:

It is also possible to generate interactive (browser-based) plots by using plot_with_bokeh instead of plot:

Nucleotide sequences, translations, and cropping

DNA Features Viewer allows to plot nucleotide or amino acid sequences under the record plot:

from dna_features_viewer import GraphicFeature, GraphicRecord

sequence = "ATGCATGCATGCATGCATGCATGCATGC"
record = GraphicRecord(sequence=sequence, features=[
    GraphicFeature(start=5, end=10, strand=+1, color='#ffcccc'),
    GraphicFeature(start=8, end=15, strand=+1, color='#ccccff')
])

ax, _ = record.plot(figure_width=5)
record.plot_sequence(ax)
record.plot_translation(ax, (8, 23), fontdict={'weight': 'bold'})
ax.figure.savefig('sequence_and_translation.png', bbox_inches='tight')

This enables for instance to plot an overview of a sequence along with a detailed detail of a sequence subsegment (full code)

...
record.plot(ax=ax1)
cropped_record = record.crop((zoom_start, zoom_end))
cropped_record.plot(ax=ax2)
cropped_record.plot_sequence(ax=ax2)
cropped_record.plot_translation(ax=ax2, location=(408, 423))

Reading the features from a GenBank or GFF file

DnaFeaturesViewer plays nice with BioPython. As a result it is super easy to plot the content of a Biopython record, or directly a GenBank (or GFF) file:

from dna_features_viewer import BiopythonTranslator
graphic_record = BiopythonTranslator().translate_record("my_sequence.gb")
ax, _ = graphic_record.plot(figure_width=10, strand_in_label_threshold=7)

Note 1: the script uses strand_in_label_threshold=7 to indicate the strand with an arrow in the annotation text for every feature less than ~7 pixels in width.

Note 2: the BiopythonTranslator class determines how the genbank information is transformed into graphical features. It enables to chose which categories of features to plot, the color of the different features.

Note 3: parsing GFF files requires the BCBio library (pip install bcbio-gff). This library also enables to extract Biopython records from GFF files containing several records (using GFF.parse("records.gff")).

Displaying the features along with other plots

As it uses Matplotlib, DNA Features Viewer can display the features on top of other sequences statistics, such as the local GC content:

import matplotlib.pyplot as plt
from dna_features_viewer import BiopythonTranslator
from Bio import SeqIO
import numpy as np

fig, (ax1, ax2) = plt.subplots(
    2, 1, figsize=(12, 3), sharex=True, gridspec_kw={"height_ratios": [4, 1]}
)

# PLOT THE RECORD MAP
record = SeqIO.read("example_sequence.gb", "genbank")
graphic_record = BiopythonTranslator().translate_record(record)
graphic_record.plot(ax=ax1, with_ruler=False, strand_in_label_threshold=4)

# PLOT THE LOCAL GC CONTENT (we use 50bp windows)
gc = lambda s: 100.0 * len([c for c in s if c in "GC"]) / 50
xx = np.arange(len(record.seq) - 50)
yy = [gc(record.seq[x : x + 50]) for x in xx]
ax2.fill_between(xx + 25, yy, alpha=0.3)
ax2.set_ylim(bottom=0)
ax2.set_ylabel("GC(%)")

Multi-line and multi-page plots

Since v3.0 it is possible to plot a sequence over multiple lines (using record.plot_on_multiple_lines()) or even on multiple pages (of a PDF):

graphic_record.plot_on_multiple_pages(
    "multipage_plot.pdf",
    nucl_per_line=70,
    lines_per_page=7,
    plot_sequence=True
)

DNA Features Viewer Logo

Custom Biopython translators

DNA Features Viewer allows to define "themes" by using custom record translators instead of the default BiopythonTranslator. Here is an example:

from dna_features_viewer import BiopythonTranslator

class MyCustomTranslator(BiopythonTranslator):
    """Custom translator implementing the following theme:

    - Color terminators in green, CDS in blue, all other features in gold.
    - Do not display features that are restriction sites unless they are BamHI
    - Do not display labels for restriction sites
    - For CDS labels just write "CDS here" instead of the name of the gene.

    """

    def compute_feature_color(self, feature):
        if feature.type == "CDS":
            return "blue"
        elif feature.type == "terminator":
            return "green"
        else:
            return "gold"

    def compute_feature_label(self, feature):
        if feature.type == 'restriction_site':
            return None
        elif feature.type == "CDS":
            return "CDS here"
        else:
            return BiopythonTranslator.compute_feature_label(self, feature)

    def compute_filtered_features(self, features):
        """Do not display promoters. Just because."""
        return [
            feature for feature in features
            if (feature.type != "restriction_site")
            or ("BamHI" in str(feature.qualifiers.get("label", '')))
        ]


graphic_record = MyCustomTranslator().translate_record("example_sequence.gb")
ax, _ = graphic_record.plot(figure_width=10)
ax.figure.tight_layout()
ax.figure.savefig("custom_bopython_translator.png")
https://raw.githubusercontent.com/Edinburgh-Genome-Foundry/DnaFeaturesViewer/master/examples/custom_biopython_translator.png

Examples in other packages:

DNA Chisel

This GIF uses DNA Features Viewer to plot the progress in the optimization of a DNA sequence with DNA Chisel. It also uses Proglog to automatically generate a picture at different time points. See the not-so-great python code for this example on Gist.

DNA Chisel algorithm

GeneBlocks

GeneBlocks is a Python library which computes "diffs" of constructs two sequences, indicating all the changes (additions, deletions, mutations). It uses DNA Features Viewer to display these changesx along with the other sequence's features.

DNA Chisel algorithm

License = MIT

DNA Features Viewer is an open-source software originally written at the Edinburgh Genome Foundry by Zulko and released on Github under the MIT licence. Everyone is welcome to contribute !

More biology software

https://raw.githubusercontent.com/Edinburgh-Genome-Foundry/Edinburgh-Genome-Foundry.github.io/master/static/imgs/logos/egf-codon-horizontal.png

DNA Features Viewer is part of the EGF Codons synthetic biology software suite for DNA design, manufacturing and validation.

About

👁️ Python library to plot DNA sequence features (e.g. from Genbank files)

Resources

License

Stars

Watchers

Forks

Releases

No releases published

Packages

No packages published

Languages

  • Python 100.0%