Hit index in the reverse complement direction

[gencouchchu]

Is it 5'-3' or 3' to 5'?

[jhkorhonen]

It's using the same indexing as the non-reverse complement hits, so if your original sequence is 3' to 5', then it's 3' to 5'. That is to say, a match with position +,x corresponds to the same portion of the orginal sequence as a match with position -,x.

An example, assume matrix length 10:

   |------->| Match with position +,4
GATGAGAGTAGTGATGAGTATG
   |<-------| Match with position -,4

[gencouchchu]

Thanks!