-
-
Notifications
You must be signed in to change notification settings - Fork 9
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
* Convert json objects to roc records and still output generated tests when roc format fails * Add nucleotide-count * use single pass and remove crash --------- Co-authored-by: Aurélien Geron <ageron@users.noreply.github.com>
- Loading branch information
1 parent
a1811aa
commit 6ef7943
Showing
9 changed files
with
159 additions
and
1 deletion.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,23 @@ | ||
# Instructions | ||
|
||
Each of us inherits from our biological parents a set of chemical instructions known as DNA that influence how our bodies are constructed. | ||
All known life depends on DNA! | ||
|
||
> Note: You do not need to understand anything about nucleotides or DNA to complete this exercise. | ||
DNA is a long chain of other chemicals and the most important are the four nucleotides, adenine, cytosine, guanine and thymine. | ||
A single DNA chain can contain billions of these four nucleotides and the order in which they occur is important! | ||
We call the order of these nucleotides in a bit of DNA a "DNA sequence". | ||
|
||
We represent a DNA sequence as an ordered collection of these four nucleotides and a common way to do that is with a string of characters such as "ATTACG" for a DNA sequence of 6 nucleotides. | ||
'A' for adenine, 'C' for cytosine, 'G' for guanine, and 'T' for thymine. | ||
|
||
Given a string representing a DNA sequence, count how many of each nucleotide is present. | ||
If the string contains characters that aren't A, C, G, or T then it is invalid and you should signal an error. | ||
|
||
For example: | ||
|
||
```text | ||
"GATTACA" -> 'A': 3, 'C': 1, 'G': 1, 'T': 2 | ||
"INVALID" -> error | ||
``` |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,12 @@ | ||
module [nucleotideCounts] | ||
|
||
nucleotideCounts : Str -> Result { a : U64, c : U64, g : U64, t : U64 } _ | ||
nucleotideCounts = \input -> | ||
Str.toUtf8 input | ||
|> List.walkTry { a: 0, c: 0, g: 0, t: 0 } \state, elem -> | ||
when elem is | ||
'A' -> Ok { state & a: state.a + 1 } | ||
'C' -> Ok { state & c: state.c + 1 } | ||
'G' -> Ok { state & g: state.g + 1 } | ||
'T' -> Ok { state & t: state.t + 1 } | ||
_ -> Err (InvalidNucleotide elem) |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,19 @@ | ||
{ | ||
"authors": [ | ||
"isaacvando" | ||
], | ||
"files": { | ||
"solution": [ | ||
"NucleotideCount.roc" | ||
], | ||
"test": [ | ||
"nucleotide-count-test.roc" | ||
], | ||
"example": [ | ||
".meta/Example.roc" | ||
] | ||
}, | ||
"blurb": "Given a DNA string, compute how many times each nucleotide occurs in the string.", | ||
"source": "The Calculating DNA Nucleotides_problem at Rosalind", | ||
"source_url": "https://rosalind.info/problems/dna/" | ||
} |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,17 @@ | ||
{%- import "generator_macros.j2" as macros with context -%} | ||
{{ macros.canonical_ref() }} | ||
{{ macros.header() }} | ||
|
||
import {{ exercise | to_pascal }} exposing [{{ cases[0]["property"] | to_camel }}] | ||
|
||
{% for case in cases -%} | ||
# {{ case["description"] }} | ||
expect | ||
result = {{ case["property"] | to_camel }} {{ case["input"]["strand"] | to_roc }} | ||
{%- if case["expected"]["error"] %} | ||
Result.isErr result | ||
{%- else %} | ||
result == Ok {{ case["expected"] | to_roc }} | ||
{%- endif %} | ||
|
||
{% endfor %} |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,25 @@ | ||
# This is an auto-generated file. | ||
# | ||
# Regenerating this file via `configlet sync` will: | ||
# - Recreate every `description` key/value pair | ||
# - Recreate every `reimplements` key/value pair, where they exist in problem-specifications | ||
# - Remove any `include = true` key/value pair (an omitted `include` key implies inclusion) | ||
# - Preserve any other key/value pair | ||
# | ||
# As user-added comments (using the # character) will be removed when this file | ||
# is regenerated, comments can be added via a `comment` key. | ||
|
||
[3e5c30a8-87e2-4845-a815-a49671ade970] | ||
description = "empty strand" | ||
|
||
[a0ea42a6-06d9-4ac6-828c-7ccaccf98fec] | ||
description = "can count one nucleotide in single-character input" | ||
|
||
[eca0d565-ed8c-43e7-9033-6cefbf5115b5] | ||
description = "strand with repeated nucleotide" | ||
|
||
[40a45eac-c83f-4740-901a-20b22d15a39f] | ||
description = "strand with multiple nucleotides" | ||
|
||
[b4c47851-ee9e-4b0a-be70-a86e343bd851] | ||
description = "strand with invalid nucleotides" |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,5 @@ | ||
module [nucleotideCounts] | ||
|
||
nucleotideCounts : Str -> Result { a : U64, c : U64, g : U64, t : U64 } _ | ||
nucleotideCounts = \input -> | ||
crash "Please implement 'nucleotideCounts'" |
37 changes: 37 additions & 0 deletions
37
exercises/practice/nucleotide-count/nucleotide-count-test.roc
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,37 @@ | ||
# These tests are auto-generated with test data from: | ||
# https://github.com/exercism/problem-specifications/tree/main/exercises/nucleotide-count/canonical-data.json | ||
# File last updated on 2024-09-22 | ||
app [main] { | ||
pf: platform "https://github.com/roc-lang/basic-cli/releases/download/0.15.0/SlwdbJ-3GR7uBWQo6zlmYWNYOxnvo8r6YABXD-45UOw.tar.br", | ||
} | ||
|
||
main = | ||
Task.ok {} | ||
|
||
import NucleotideCount exposing [nucleotideCounts] | ||
|
||
# empty strand | ||
expect | ||
result = nucleotideCounts "" | ||
result == Ok { a: 0, c: 0, g: 0, t: 0 } | ||
|
||
# can count one nucleotide in single-character input | ||
expect | ||
result = nucleotideCounts "G" | ||
result == Ok { a: 0, c: 0, g: 1, t: 0 } | ||
|
||
# strand with repeated nucleotide | ||
expect | ||
result = nucleotideCounts "GGGGGGG" | ||
result == Ok { a: 0, c: 0, g: 7, t: 0 } | ||
|
||
# strand with multiple nucleotides | ||
expect | ||
result = nucleotideCounts "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC" | ||
result == Ok { a: 20, c: 12, g: 17, t: 21 } | ||
|
||
# strand with invalid nucleotides | ||
expect | ||
result = nucleotideCounts "AGXXACT" | ||
Result.isErr result | ||
|