Add nucleotide-count (#111)

* Convert json objects to roc records and still output generated tests when roc format fails
* Add nucleotide-count
* use single pass and remove crash

---------

Co-authored-by: Aurélien Geron <ageron@users.noreply.github.com>

bin/generate_tests.py

@@ -167,6 +167,15 @@ def to_roc_tuple(values: Any):
     list_content = ", ".join([to_roc(v) for v in tuple(values)])
     return f"({list_content})"
 
+def to_roc_record(obj: Dict[str, Any]):
+    items = []
+    for key, value in obj.items():
+        camel_key = to_camel(key)
+        roc_value = to_roc(value)
+        items.append(f"{camel_key}: {roc_value}")
+
+    return "{ " + ", ".join(items) + " }"
+
 
 def to_roc_bool(value: bool):
     return "Bool.true" if value else "Bool.false"
@@ -193,6 +202,8 @@ def to_roc(value: Any) -> str:
         return to_roc_list(value)
     elif isinstance(value, tuple):
         return to_roc_tuple(value)
+    elif isinstance(value, dict):
+        return to_roc_record(value)
     elif value is None:
         return "{}"
     else:
@@ -481,7 +492,7 @@ def generate_exercise(
             logger.debug(f"{slug}: formatting tmp file {tmpfile}")
             format_file(tmpfile)
         except subprocess.CalledProcessError as e:
-            return False
+            pass
 
         if check:
             return check_template(slug, tests_path, tmpfile)
@@ -545,6 +556,7 @@ def generate(
     env.filters["to_roc_bool"] = to_roc_bool
     env.filters["to_roc_list"] = to_roc_list
     env.filters["to_roc_tuple"] = to_roc_tuple
+    env.filters["to_roc_record"] = to_roc_record
     env.filters["wrap_overlong"] = wrap_overlong
     env.filters["regex_replace"] = regex_replace
     env.filters["regex_find"] = regex_find

config.json

@@ -143,6 +143,14 @@
         "prerequisites": [],
         "difficulty": 2
       },
+      {
+        "slug": "nucleotide-count",
+        "name": "Nucleotide Count",
+        "uuid": "9f07740b-eb8a-45f9-a137-e2930a224815",
+        "practices": [],
+        "prerequisites": [],
+        "difficulty": 2
+      },
       {
         "slug": "rna-transcription",
         "name": "RNA Transcription",

exercises/practice/nucleotide-count/.docs/instructions.md

@@ -0,0 +1,23 @@
+# Instructions
+
+Each of us inherits from our biological parents a set of chemical instructions known as DNA that influence how our bodies are constructed.
+All known life depends on DNA!
+
+> Note: You do not need to understand anything about nucleotides or DNA to complete this exercise.
+
+DNA is a long chain of other chemicals and the most important are the four nucleotides, adenine, cytosine, guanine and thymine.
+A single DNA chain can contain billions of these four nucleotides and the order in which they occur is important!
+We call the order of these nucleotides in a bit of DNA a "DNA sequence".
+
+We represent a DNA sequence as an ordered collection of these four nucleotides and a common way to do that is with a string of characters such as "ATTACG" for a DNA sequence of 6 nucleotides.
+'A' for adenine, 'C' for cytosine, 'G' for guanine, and 'T' for thymine.
+
+Given a string representing a DNA sequence, count how many of each nucleotide is present.
+If the string contains characters that aren't A, C, G, or T then it is invalid and you should signal an error.
+
+For example:
+
+```text
+"GATTACA" -> 'A': 3, 'C': 1, 'G': 1, 'T': 2
+"INVALID" -> error
+```

exercises/practice/nucleotide-count/.meta/Example.roc

@@ -0,0 +1,12 @@
+module [nucleotideCounts]
+
+nucleotideCounts : Str -> Result { a : U64, c : U64, g : U64, t : U64 } _
+nucleotideCounts = \input ->
+    Str.toUtf8 input
+    |> List.walkTry { a: 0, c: 0, g: 0, t: 0 } \state, elem ->
+        when elem is
+            'A' -> Ok { state & a: state.a + 1 }
+            'C' -> Ok { state & c: state.c + 1 }
+            'G' -> Ok { state & g: state.g + 1 }
+            'T' -> Ok { state & t: state.t + 1 }
+            _ -> Err (InvalidNucleotide elem)

exercises/practice/nucleotide-count/.meta/config.json

@@ -0,0 +1,19 @@
+{
+  "authors": [
+    "isaacvando"
+  ],
+  "files": {
+    "solution": [
+      "NucleotideCount.roc"
+    ],
+    "test": [
+      "nucleotide-count-test.roc"
+    ],
+    "example": [
+      ".meta/Example.roc"
+    ]
+  },
+  "blurb": "Given a DNA string, compute how many times each nucleotide occurs in the string.",
+  "source": "The Calculating DNA Nucleotides_problem at Rosalind",
+  "source_url": "https://rosalind.info/problems/dna/"
+}

exercises/practice/nucleotide-count/.meta/template.j2

@@ -0,0 +1,17 @@
+{%- import "generator_macros.j2" as macros with context -%}
+{{ macros.canonical_ref() }}
+{{ macros.header() }}
+
+import {{ exercise | to_pascal }} exposing [{{ cases[0]["property"] | to_camel }}]
+
+{% for case in cases -%}
+# {{ case["description"] }}
+expect
+    result = {{ case["property"] | to_camel }} {{ case["input"]["strand"] | to_roc }}
+    {%- if case["expected"]["error"] %}
+    Result.isErr result
+    {%- else %}
+    result == Ok {{ case["expected"] | to_roc }}
+    {%- endif %}
+
+{% endfor %}

exercises/practice/nucleotide-count/.meta/tests.toml

@@ -0,0 +1,25 @@
+# This is an auto-generated file.
+#
+# Regenerating this file via `configlet sync` will:
+# - Recreate every `description` key/value pair
+# - Recreate every `reimplements` key/value pair, where they exist in problem-specifications
+# - Remove any `include = true` key/value pair (an omitted `include` key implies inclusion)
+# - Preserve any other key/value pair
+#
+# As user-added comments (using the # character) will be removed when this file
+# is regenerated, comments can be added via a `comment` key.
+
+[3e5c30a8-87e2-4845-a815-a49671ade970]
+description = "empty strand"
+
+[a0ea42a6-06d9-4ac6-828c-7ccaccf98fec]
+description = "can count one nucleotide in single-character input"
+
+[eca0d565-ed8c-43e7-9033-6cefbf5115b5]
+description = "strand with repeated nucleotide"
+
+[40a45eac-c83f-4740-901a-20b22d15a39f]
+description = "strand with multiple nucleotides"
+
+[b4c47851-ee9e-4b0a-be70-a86e343bd851]
+description = "strand with invalid nucleotides"

exercises/practice/nucleotide-count/NucleotideCount.roc

@@ -0,0 +1,5 @@
+module [nucleotideCounts]
+
+nucleotideCounts : Str -> Result { a : U64, c : U64, g : U64, t : U64 } _
+nucleotideCounts = \input ->
+    crash "Please implement 'nucleotideCounts'"

exercises/practice/nucleotide-count/nucleotide-count-test.roc

@@ -0,0 +1,37 @@
+# These tests are auto-generated with test data from:
+# https://github.com/exercism/problem-specifications/tree/main/exercises/nucleotide-count/canonical-data.json
+# File last updated on 2024-09-22
+app [main] {
+    pf: platform "https://github.com/roc-lang/basic-cli/releases/download/0.15.0/SlwdbJ-3GR7uBWQo6zlmYWNYOxnvo8r6YABXD-45UOw.tar.br",
+}
+
+main =
+    Task.ok {}
+
+import NucleotideCount exposing [nucleotideCounts]
+
+# empty strand
+expect
+    result = nucleotideCounts ""
+    result == Ok { a: 0, c: 0, g: 0, t: 0 }
+
+# can count one nucleotide in single-character input
+expect
+    result = nucleotideCounts "G"
+    result == Ok { a: 0, c: 0, g: 1, t: 0 }
+
+# strand with repeated nucleotide
+expect
+    result = nucleotideCounts "GGGGGGG"
+    result == Ok { a: 0, c: 0, g: 7, t: 0 }
+
+# strand with multiple nucleotides
+expect
+    result = nucleotideCounts "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"
+    result == Ok { a: 20, c: 12, g: 17, t: 21 }
+
+# strand with invalid nucleotides
+expect
+    result = nucleotideCounts "AGXXACT"
+    Result.isErr result
+