Protocols

Explant disinfection + Callus Induction Media: https://sci-hub.se/https://link.springer.com/chapter/10.1007/1-4020-2985-3_14

Construction of Transformation Vectors: https://blog.addgene.org/rna-interference-in-plant-biology-new-tools-for-an-old-favorite 

Adapted Agrobacterium Mediated Transformation: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3111370/

Planned steps:

RT-PCR to quantify caffeine synthase expression: https://www.thermofisher.com/us/en/home/brands/thermo-scientific/molecular-biology/molecular-biology-learning-center/molecular-biology-resource-library/spotlight-articles/basic-principles-rt-qpcr.html
(Note: Temperature and other paramters are set by the primers I designed for quantifying gene expression of the caffeine synthase gene)

Primer sequences to quantify effect of RNAi transformation vector on caffeine syntheae (DXMT) gene expression in Coffea Arabica: 

	Sequence (5'->3')	Template strand	Length	Start	Stop	Tm	GC%	Self complementarity	Self 3' complementarity
Forward primer	CCGCCCATCAAGAAGGCATA	Plus	20	698	717	60.18	55.00	4.00	2.00
Reverse primer	GTCCATGGAATTCGGGTGGT	Minus	20	847	828	60.03	55.00	8.00	2.00
Product length	150