Deployed 113a6de with MkDocs version: 1.6.0

RIVM-bioinformatics · Jul 3, 2024 · eb48408 · eb48408
commit eb48408
Show file tree

Hide file tree

Showing 28 changed files with 5,459 additions and 0 deletions.
diff --git a/.nojekyll b/.nojekyll
diff --git a/changelog/index.html b/changelog/index.html
diff --git a/css/base.css b/css/base.css
@@ -0,0 +1,117 @@
+body {
+    padding-top: 70px;
+}
+
+h1[id]:before, h2[id]:before, h3[id]:before, h4[id]:before, h5[id]:before, h6[id]:before {
+    content: "";
+    display: block;
+    margin-top: -75px;
+    height: 75px;
+}
+
+ul.nav li.main {
+    font-weight: bold;
+}
+
+div.col-md-3 {
+    padding-left: 0;
+}
+
+div.col-md-9 {
+    padding-bottom: 100px;
+}
+
+div.source-links {
+    float: right;
+}
+
+div.col-md-9 img {
+  max-width: 100%;
+}
+
+/*
+ * Side navigation
+ *
+ * Scrollspy and affixed enhanced navigation to highlight sections and secondary
+ * sections of docs content.
+ */
+
+/* By default it's not affixed in mobile views, so undo that */
+.bs-sidebar.affix {
+    position: static;
+}
+
+.bs-sidebar.well {
+    padding: 0;
+}
+
+/* First level of nav */
+.bs-sidenav {
+    margin-top: 30px;
+    margin-bottom: 30px;
+    padding-top:    10px;
+    padding-bottom: 10px;
+    border-radius: 5px;
+}
+
+/* All levels of nav */
+.bs-sidebar .nav > li > a {
+    display: block;
+    padding: 5px 20px;
+    z-index: 1;
+}
+.bs-sidebar .nav > li > a:hover,
+.bs-sidebar .nav > li > a:focus {
+    text-decoration: none;
+    border-right: 1px solid;
+}
+.bs-sidebar .nav > .active > a,
+.bs-sidebar .nav > .active:hover > a,
+.bs-sidebar .nav > .active:focus > a {
+    font-weight: bold;
+    background-color: transparent;
+    border-right: 1px solid;
+}
+
+/* Nav: second level (shown on .active) */
+.bs-sidebar .nav .nav {
+    display: none; /* Hide by default, but at >768px, show it */
+    margin-bottom: 8px;
+}
+.bs-sidebar .nav .nav > li > a {
+    padding-top:    3px;
+    padding-bottom: 3px;
+    padding-left: 30px;
+    font-size: 90%;
+}
+
+/* Show and affix the side nav when space allows it */
+@media (min-width: 992px) {
+    .bs-sidebar .nav > .active > ul {
+        display: block;
+    }
+    /* Widen the fixed sidebar */
+    .bs-sidebar.affix,
+    .bs-sidebar.affix-bottom {
+        width: 213px;
+    }
+    .bs-sidebar.affix {
+        position: fixed; /* Undo the static from mobile first approach */
+        top: 80px;
+    }
+    .bs-sidebar.affix-bottom {
+        position: absolute; /* Undo the static from mobile first approach */
+    }
+    .bs-sidebar.affix-bottom .bs-sidenav,
+    .bs-sidebar.affix .bs-sidenav {
+        margin-top: 0;
+        margin-bottom: 0;
+    }
+}
+@media (min-width: 1200px) {
+    /* Widen the fixed sidebar again */
+    .bs-sidebar.affix-bottom,
+    .bs-sidebar.affix {
+        width: 263px;
+    }
+}
diff --git a/css/bootstrap.min.css b/css/bootstrap.min.css
diff --git a/css/font-awesome.min.css b/css/font-awesome.min.css
diff --git a/css/highlight.min.css b/css/highlight.min.css
diff --git a/fonts/fontawesome-webfont.eot b/fonts/fontawesome-webfont.eot
diff --git a/fonts/fontawesome-webfont.svg b/fonts/fontawesome-webfont.svg
diff --git a/fonts/fontawesome-webfont.ttf b/fonts/fontawesome-webfont.ttf
diff --git a/fonts/fontawesome-webfont.woff b/fonts/fontawesome-webfont.woff
diff --git a/fonts/fontawesome-webfont.woff2 b/fonts/fontawesome-webfont.woff2
diff --git a/fonts/glyphicons-halflings-regular.eot b/fonts/glyphicons-halflings-regular.eot
diff --git a/fonts/glyphicons-halflings-regular.svg b/fonts/glyphicons-halflings-regular.svg
diff --git a/fonts/glyphicons-halflings-regular.ttf b/fonts/glyphicons-halflings-regular.ttf
diff --git a/fonts/glyphicons-halflings-regular.woff b/fonts/glyphicons-halflings-regular.woff
diff --git a/fonts/glyphicons-halflings-regular.woff2 b/fonts/glyphicons-halflings-regular.woff2
diff --git a/img/favicon.ico b/img/favicon.ico
diff --git a/index.html b/index.html
@@ -0,0 +1,258 @@
+<!DOCTYPE html>
+<html lang="en">
+    <head>
+        <meta charset="utf-8">
+        <meta http-equiv="X-UA-Compatible" content="IE=edge">
+        <meta name="viewport" content="width=device-width, initial-scale=1.0">
+
+
+
+        <link rel="shortcut icon" href="./img/favicon.ico">
+
+        <title>Home - SARS2seq</title>
+
+        <link href="./css/bootstrap.min.css" rel="stylesheet">
+        <link href="./css/font-awesome.min.css" rel="stylesheet">
+        <link rel="stylesheet" href="./css/highlight.min.css">
+        <link href="./css/base.css" rel="stylesheet">
+
+        <!-- HTML5 shim and Respond.js IE8 support of HTML5 elements and media queries -->
+        <!--[if lt IE 9]>
+            <script src="https://oss.maxcdn.com/libs/html5shiv/3.7.0/html5shiv.js"></script>
+            <script src="https://oss.maxcdn.com/libs/respond.js/1.3.0/respond.min.js"></script>
+        <![endif]-->
+
+    </head>
+
+    <body>
+
+        <div class="navbar navbar-default navbar-fixed-top" role="navigation">
+    <div class="container">
+
+        <!-- Collapsed navigation -->
+        <div class="navbar-header">
+            <!-- Expander button -->
+            <button type="button" class="navbar-toggle" data-toggle="collapse" data-target=".navbar-collapse">
+                <span class="sr-only">Toggle navigation</span>
+                <span class="icon-bar"></span>
+                <span class="icon-bar"></span>
+                <span class="icon-bar"></span>
+            </button>
+
+            <!-- Main title -->
+            <a class="navbar-brand" href=".">
+
+            SARS2seq
+            </a>
+        </div>
+
+        <!-- Expanded navigation -->
+        <div class="navbar-collapse collapse">
+            <!-- Main navigation -->
+            <ul class="nav navbar-nav">
+
+
+
+
+
+
+
+
+
+            </ul>
+
+            <!-- Search, Navigation and Repo links -->
+            <ul class="nav navbar-nav navbar-right">
+
+
+
+
+
+
+                <li >
+                    <a href="changelog/">
+                      Changelog
+                    </a>
+                </li>
+
+
+
+
+
+
+                <li>
+                    <a href="https://github.com/RIVM-bioinformatics/SARS2seq">
+
+                            <i class="fa fa-code-fork"></i>
+
+                        Github
+                    </a>
+                </li>
+
+            </ul>
+        </div>
+    </div>
+</div>
+
+        <div class="container">
+            <div class="col-md-3">
+
+<div class="bs-sidebar hidden-print affix well" role="complementary">
+    <ul class="nav bs-sidenav">
+
+        <li class="main active"><a href="#sars2seq">SARS2seq</a></li>
+
+            <li><a href="#download-installation">Download &amp; installation</a></li>
+
+            <li><a href="#preparing-input-primer-file">Preparing input primer file</a></li>
+
+            <li><a href="#running-an-analysis">Running an analysis</a></li>
+
+            <li><a href="#authors">Authors</a></li>
+
+            <li><a href="#acknowledgements">Acknowledgements</a></li>
+
+
+    </ul>
+</div>
+
+</div>
+            <div class="col-md-9" role="main">
+
+<h1 id="sars2seq">SARS2seq</h1>
+<p><a href="https://www.codefactor.io/repository/github/rivm-bioinformatics/sars2seq"><img alt="CodeFactor" src="https://www.codefactor.io/repository/github/rivm-bioinformatics/sars2seq/badge" /></a>
+<img alt="GitHub top language" src="https://img.shields.io/github/languages/top/RIVM-bioinformatics/SARS2seq" />
+<img alt="Snakemake" src="https://img.shields.io/badge/snakemake-6.13.1-brightgreen.svg?style=flat-square" /></p>
+<p><img alt="GitHub release (latest by date including pre-releases)" src="https://img.shields.io/github/v/release/RIVM-bioinformatics/SARS2seq?include_prereleases" />
+<img alt="GitHub" src="https://img.shields.io/github/license/RIVM-bioinformatics/SARS2seq" /></p>
+<hr />
+<p>SARS2seq is a pipeline designed to process raw FastQ data from targeted SARS2-CoV-2 sequencing and generate biologically correct consensus sequences of the SARS-CoV-2 genome.</p>
+<p>SARS2seq performs high speed data quality control and data cleanup, and high accuracy removal of primer-sequences from NGS reads. As well as alignment of reads and generation of a consensus sequence using a custom consensus caller which accounts for sequencing errors and alignment artefacts.</p>
+<p>SARS2seq is able to run both on a standalone (linux) computer, as well as High-Performance Computing (HPC) infrastructures.</p>
+<hr />
+<h2 id="download-installation">Download &amp; installation</h2>
+<p><strong><em>Download and installation instructions through conda will be made available as soon as possible.</em></strong><br />
+<strong><em>Until then, please perform manual installation as described here</em></strong></p>
+<h3 id="download">Download</h3>
+<p>Use the following command to download the latest release of SARS2seq and move to the newly downloaded <code>SARS2seq/</code> directory:</p>
+<pre><code class="language-bash">git clone https://github.com/RIVM-bioinformatics/SARS2seq.git; cd SARS2seq; git checkout tags/$(git tag --sort=committerdate | tail -1) &gt;&gt; /dev/null
+</code></pre>
+<h3 id="installation">Installation</h3>
+<p><strong>Before you install SARS2seq, make sure <a href="https://docs.conda.io/projects/conda/en/latest/index.html">Conda</a> is installed on your system and functioning properly!</strong></p>
+<ol>
+<li>
+<p>Create the required conda-environment and install the necessary dependencies.<br />
+    Copy and paste the code-snippet below in order to create the new conda-environment and directly activate it.  </p>
+<p><code>mamba env create -f env.yml &amp;&amp; conda activate SARS2seq</code></p>
+<p><strong>The "SARS2seq" environment should now be active</strong>  </p>
+</li>
+<li>
+<p>You can now actually install SARS2seq to your system with: <code>pip install .</code></p>
+<p>If that command didn't work for you then use the following: <code>python setup.py install</code></p>
+</li>
+</ol>
+<p>SARS2seq is now installed!<br />
+You can start SARS2seq from anywhere on your system as long as the SARS2seq conda-environment is active.<br />
+You can also use SARS2seq in a different conda-environment as long as the software dependencies match.</p>
+<h3 id="auto-updating">Auto-updating</h3>
+<p>Since version <code>v0.3.1</code>, SARS2seq is able to update itself to the latest released version.<br />
+This makes it easier for everyone to use the latest available version without having to manually check the GitHub releases.</p>
+<p>During first-usage of SARS2seq you will be asked to configure your preffered settings for auto-updating. (enabled/disabled/ask-everytime).</p>
+<p>If you wish to run SARS2seq without the (auto-)updater checking for new releases, then add the <code>--skip-updates</code> flag to your command. In this case you will <strong>not</strong> be notified if there is a new release available, nor will your version of SARS2seq be updated.  </p>
+<hr />
+<h2 id="preparing-input-primer-file">Preparing input primer file</h2>
+<p>In order to get optimal results, make sure the fasta headers in your fasta file with primers is formatted properly.
+Please make sure the fasta headers for your primers are formatted in the following format:</p>
+<p><code>&gt;{primer-name}_{primer-number}_{orientation}</code></p>
+<p>Orientation keywords for forward primers are: LEFT/PLUS/POSITIVE/FORWARD<br />
+Orientation keywords for reverse primers are: RIGHT/MINUS/NEGATIVE/REVERSE  </p>
+<p>Below is an example of formatted primer names from the <a href="https://github.com/artic-network/artic-ncov2019/tree/master/primer_schemes/nCoV-2019/V3">ArticV3</a> sequencing protocol:</p>
+<pre><code class="language-Markdown">&gt;nCoV-2019_1_LEFT  
+ACCAACCAACTTTCGATCTCTTGT  
+&gt;nCoV-2019_1_RIGHT  
+CATCTTTAAGATGTTGACGTGCCTC  
+&gt;nCoV-2019_2_LEFT  
+CTGTTTTACAGGTTCGCGACGT  
+&gt;nCoV-2019_2_RIGHT  
+TAAGGATCAGTGCCAAGCTCGT
+</code></pre>
+<p>If your protocol has alternative primers then make sure the fasta header contains the "alt" keyword in the following format:</p>
+<p><code>&gt;{primer-name}_{primer-number}_alt_{orientation}</code>  </p>
+<p>Make sure the "alt" keyword is in the middle and not at the end of the fasta header.</p>
+<p>Below is an example of formatted primer names from the <a href="https://github.com/artic-network/artic-ncov2019/tree/master/primer_schemes/nCoV-2019/V3">ArticV3</a> sequencing protocol with alternative primers included:</p>
+<pre><code class="language-Markdown">&gt;nCoV-2019_13_LEFT  
+TCGCACAAATGTCTACTTAGCTGT  
+&gt;nCoV-2019_13_RIGHT  
+ACCACAGCAGTTAAAACACCCT  
+&gt;nCoV-2019_14_LEFT  
+CATCCAGATTCTGCCACTCTTGT  
+&gt;nCoV-2019_14_alt_LEFT  
+TGGCAATCTTCATCCAGATTCTGC  
+&gt;nCoV-2019_14_RIGHT  
+AGTTTCCACACAGACAGGCATT  
+&gt;nCoV-2019_14_alt_RIGHT  
+TGCGTGTTTCTTCTGCATGTGC  
+&gt;nCoV-2019_15_LEFT  
+ACAGTGCTTAAAAAGTGTAAAAGTGCC  
+&gt;nCoV-2019_15_alt_LEFT  
+AGTGCTTAAAAAGTGTAAAAGTGCCT  
+&gt;nCoV-2019_15_RIGHT  
+AACAGAAACTGTAGCTGGCACT  
+&gt;nCoV-2019_15_alt_RIGHT  
+ACTGTAGCTGGCACTTTGAGAGA
+</code></pre>
+<p>Formatting your input primer file as above ensures the best results for your analysis.</p>
+<hr />
+<h2 id="running-an-analysis">Running an analysis</h2>
+<p>Please see the command line help for a quick explanation of every possible argument: <code>sars2seq -h</code></p>
+<p>You can start an analysis with a command such as the following:</p>
+<pre><code class="language-bash">sars2seq \
+    --input {path/to/FastQ-files} \
+    --output {path/to/desired-output} \
+    --primers {path/to/primers.fasta/NONE} \
+    --platform {nanopore/illumina/iontorrent} \
+    --amplicon-type {end-to-end/end-to-mid} \
+    --threads {threads}
+</code></pre>
+<p>Here, threads refers to the amount of threads that SARS2seq may use on your LOCAL machine. If you're using SARS2seq on a HPC/cluster then these threads will only be used during the pre-processing steps.<br />
+If you're using SARS2seq on your local machine then the given amount of threads will act as a 'ceiling' of threads during analysis.</p>
+<p>If your protocol does not use primers then set "NONE" for the primers flag with: <code>--primers NONE</code></p>
+<p>The <code>--amplicon-type</code> flag is used to clarify the length of of the sequenced read in regards to the amplicon.<br />
+"end-to-end" means that the sequenced read covers the full length of the amplicon, meaning that the primer-sequence is present at both ends of a read.
+"end-to-mid" means that the sequenced read <em>partially</em> covers the length of the amplicon, meaning that the primer-sequence is present at only one end of a read.<br />
+Please see <a href="https://rivm-bioinformatics.github.io/AmpliGone/latest/amplicon-types/">this link</a> for a more detailed explanation of the terminology.  </p>
+<p>Please check your sequencing and laboratory setup to ensure the best results.</p>
+<hr />
+<h2 id="authors">Authors</h2>
+<ul>
+<li>Florian Zwagemaker</li>
+<li>Dennis Schmitz</li>
+<li>Karim Hajji</li>
+<li>Annelies Kroneman</li>
+</ul>
+<h2 id="acknowledgements">Acknowledgements</h2>
+<ul>
+<li>Harry Vennema</li>
+<li>Dirk Eggink</li>
+<li>Jeroen Cremer</li>
+<li>Jeroen Laros </li>
+<li>Robert Verhagen</li>
+<li>Erwin van Wieringen</li>
+</ul></div>
+        </div>
+
+    <footer class="col-md-12">
+        <hr>
+
+        <center>copyright © 2021 RIVM</center>
+
+    </footer>
+
+        <script src="./js/jquery.min.js"></script>
+        <script src="./js/bootstrap.min.js"></script>
+        <script src="./js/highlight.min.js"></script>
+        <script>hljs.initHighlightingOnLoad();</script>
+        <script src="./js/base.js"></script>
+        <script src="search/main.js"></script>
+    </body>
+</html>