Skip to content

Commit

Permalink
Fix features docs
Browse files Browse the repository at this point in the history 
- it said `repp builde features`.. it should be `repp make features`
  • Loading branch information
@jjti
jjti committed Jan 29, 2020
1 parent e487a92 commit b29cb7f
Show file tree
Hide file tree
Showing 17 changed files with 18 additions and 18 deletions.
2 changes: 1 addition & 1 deletion cmd/set.go
View file
Original file line number Diff line number Diff line change
Expand Up @@ -22,7 +22,7 @@ var featureCreateCmd = &cobra.Command{
Short: "Add a feature to the features database",
Run: featureDB.SetCmd,
SuggestionsMinimumDistance: 2,
Long: "\nSet a feature in the features database so it can be use used in 'repp builde features'",
Long: "\nSet a feature in the features database so it can be use used in 'repp make features'",
Aliases: []string{"add", "update"},
Example: " repp set feature \"custom terminator 3\" CTAGCATAACAAGCTTGGGCACCTGTAAACGGGTCTTGAGGGGTTCCATTTTG",
}
Expand Down
2 changes: 1 addition & 1 deletion docs/repp.md
View file
Original file line number Diff line number Diff line change
Expand Up @@ -33,4 +33,4 @@ their sequence, features, or fragments
* [repp make](repp_make) - Make a plasmid from its expected sequence, features or fragments
* [repp set](repp_set) - Set a feature or enzyme

###### Auto generated by spf13/cobra on 21-Jan-2020
###### Auto generated by spf13/cobra on 29-Jan-2020
2 changes: 1 addition & 1 deletion docs/repp_annotate.md
View file
Original file line number Diff line number Diff line change
Expand Up @@ -46,4 +46,4 @@ repp annotate [seq] [flags]
Repository-based plasmid design. Specify and build plasmids using
their sequence, features, or fragments

###### Auto generated by spf13/cobra on 21-Jan-2020
###### Auto generated by spf13/cobra on 29-Jan-2020
2 changes: 1 addition & 1 deletion docs/repp_delete.md
View file
Original file line number Diff line number Diff line change
Expand Up @@ -27,4 +27,4 @@ Repository-based plasmid design. Specify and build plasmids using
their sequence, features, or fragments
* [repp delete feature](repp_delete_feature) - Delete a feature from the features database

###### Auto generated by spf13/cobra on 21-Jan-2020
###### Auto generated by spf13/cobra on 29-Jan-2020
2 changes: 1 addition & 1 deletion docs/repp_delete_feature.md
View file
Original file line number Diff line number Diff line change
Expand Up @@ -34,4 +34,4 @@ repp delete feature [name] [flags]

* [repp delete](repp_delete) - Delete a feature

###### Auto generated by spf13/cobra on 21-Jan-2020
###### Auto generated by spf13/cobra on 29-Jan-2020
2 changes: 1 addition & 1 deletion docs/repp_find.md
View file
Original file line number Diff line number Diff line change
Expand Up @@ -31,4 +31,4 @@ their sequence, features, or fragments
* [repp find fragment](repp_find_fragment) - Find a fragment in the databases
* [repp find sequence](repp_find_sequence) - Find a sequence in the databases

###### Auto generated by spf13/cobra on 21-Jan-2020
###### Auto generated by spf13/cobra on 29-Jan-2020
2 changes: 1 addition & 1 deletion docs/repp_find_enzyme.md
View file
Original file line number Diff line number Diff line change
Expand Up @@ -35,4 +35,4 @@ repp find enzyme [name] [flags]

* [repp find](repp_find) - Find features or enzymes

###### Auto generated by spf13/cobra on 21-Jan-2020
###### Auto generated by spf13/cobra on 29-Jan-2020
2 changes: 1 addition & 1 deletion docs/repp_find_feature.md
View file
Original file line number Diff line number Diff line change
Expand Up @@ -37,4 +37,4 @@ repp find feature [name] [flags]

* [repp find](repp_find) - Find features or enzymes

###### Auto generated by spf13/cobra on 21-Jan-2020
###### Auto generated by spf13/cobra on 29-Jan-2020
2 changes: 1 addition & 1 deletion docs/repp_find_fragment.md
View file
Original file line number Diff line number Diff line change
Expand Up @@ -37,4 +37,4 @@ repp find fragment [name] [flags]

* [repp find](repp_find) - Find features or enzymes

###### Auto generated by spf13/cobra on 21-Jan-2020
###### Auto generated by spf13/cobra on 29-Jan-2020
2 changes: 1 addition & 1 deletion docs/repp_find_sequence.md
View file
Original file line number Diff line number Diff line change
Expand Up @@ -39,4 +39,4 @@ repp find sequence [seq] [flags]

* [repp find](repp_find) - Find features or enzymes

###### Auto generated by spf13/cobra on 21-Jan-2020
###### Auto generated by spf13/cobra on 29-Jan-2020
2 changes: 1 addition & 1 deletion docs/repp_make.md
View file
Original file line number Diff line number Diff line change
Expand Up @@ -32,4 +32,4 @@ their sequence, features, or fragments
* [repp make fragments](repp_make_fragments) - Build a plasmid from its constituent fragments
* [repp make sequence](repp_make_sequence) - Find or build a plasmid from its target sequence

###### Auto generated by spf13/cobra on 21-Jan-2020
###### Auto generated by spf13/cobra on 29-Jan-2020
2 changes: 1 addition & 1 deletion docs/repp_make_features.md
View file
Original file line number Diff line number Diff line change
Expand Up @@ -52,4 +52,4 @@ repp make features "BBa_R0062,BBa_B0034,BBa_C0040,BBa_B0010,BBa_B0012" --backbon

* [repp make](repp_make) - Make a plasmid from its expected sequence, features or fragments

###### Auto generated by spf13/cobra on 21-Jan-2020
###### Auto generated by spf13/cobra on 29-Jan-2020
2 changes: 1 addition & 1 deletion docs/repp_make_fragments.md
View file
Original file line number Diff line number Diff line change
Expand Up @@ -47,4 +47,4 @@ repp make fragments [flags]

* [repp make](repp_make) - Make a plasmid from its expected sequence, features or fragments

###### Auto generated by spf13/cobra on 21-Jan-2020
###### Auto generated by spf13/cobra on 29-Jan-2020
2 changes: 1 addition & 1 deletion docs/repp_make_sequence.md
View file
Original file line number Diff line number Diff line change
Expand Up @@ -56,4 +56,4 @@ repp make sequence -i "./target_plasmid.fa --addgene --dbs "part_library.fa"

* [repp make](repp_make) - Make a plasmid from its expected sequence, features or fragments

###### Auto generated by spf13/cobra on 21-Jan-2020
###### Auto generated by spf13/cobra on 29-Jan-2020
2 changes: 1 addition & 1 deletion docs/repp_set.md
View file
Original file line number Diff line number Diff line change
Expand Up @@ -30,4 +30,4 @@ their sequence, features, or fragments
* [repp set enzyme](repp_set_enzyme) - Add an enzyme to the enzymes database
* [repp set feature](repp_set_feature) - Add a feature to the features database

###### Auto generated by spf13/cobra on 21-Jan-2020
###### Auto generated by spf13/cobra on 29-Jan-2020
2 changes: 1 addition & 1 deletion docs/repp_set_enzyme.md
View file
Original file line number Diff line number Diff line change
Expand Up @@ -38,4 +38,4 @@ repp set enzyme [name] [sequence] [flags]

* [repp set](repp_set) - Set a feature or enzyme

###### Auto generated by spf13/cobra on 21-Jan-2020
###### Auto generated by spf13/cobra on 29-Jan-2020
4 changes: 2 additions & 2 deletions docs/repp_set_feature.md
View file
Original file line number Diff line number Diff line change
Expand Up @@ -12,7 +12,7 @@ Add a feature to the features database
### Synopsis


Set a feature in the features database so it can be use used in 'repp builde features'
Set a feature in the features database so it can be use used in 'repp make features'

```
repp set feature [name] [sequence] [flags]
Expand All @@ -34,4 +34,4 @@ repp set feature [name] [sequence] [flags]

* [repp set](repp_set) - Set a feature or enzyme

###### Auto generated by spf13/cobra on 21-Jan-2020
###### Auto generated by spf13/cobra on 29-Jan-2020

0 comments on commit b29cb7f

Please sign in to comment.